djgraham354 djgraham354
  • 13-04-2022
  • Geography
contestada

The way all jobs in modern society are connected to other jobs is called?

Respuesta :

Аноним Аноним
  • 13-04-2022

Answer:

Division of labor

Explanation:

Answer Link

Otras preguntas

Question 1 Next > Which of the following pathways produces a new, fertilized egg cell? Mitosis produces gametes, the gametes fuse to form the new fertilized
what is 763 thousandths in scientific notation
edhesive 4.8 question 3​
Read the transcript of General Dwight D. Eisenhower’s speech “Order of the Day” from 1944. What is the purpose of the passage?
PLS HELP4. What does the y-intercept of the graph of Monday's storm mean? Does the y-intercept of the graph of Thursday's storm have the same meaning?
Find the zeros for the given equation hurry!!!!
What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA
are there explanations for the falso ones?
Roberto spent $49.62 for 6 T-shirts. Which number sentence shows the best way to estimate the cost of each T-shirt? A. $45 ÷ 5 = $9 B. $48 ÷ 6 = $8 C. $50 ÷
How can we ensure that conflicts lead to constructive change and a positive outcome for everyone involved? Help ASAP