ricorico01 ricorico01

11-11-2020
Biology

contestada

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Respuesta :

stefftagalilong stefftagalilong

19-11-2020

Answer:

what I don't understand what is the Ctcagt

Answer Link

Otras preguntas

At Random Stationary, the sales records of 24 employees were examined. Twelve of the employees worked the morning shifts and 12 of them worked the afternoon shi

Mr. Cavor’s comments about Mr. Bedford in his letters cause the reader to question which aspect of Mr. Bedford’s character? His business intentions His omniscie

what bacteria causes strep throat

please help soon! I will mark brainiest

According to the myth, how does the grandmother spider help the twins escape from the giant?

you have a $20 bill. If you buy 24 pensa and 12 pencils, you will get $1.40 change. If you buy 12 pens and 24 pencils, you will get 4.40 change. How much does e

What is the reason for step 3 of this proof

what type of diffusion describes how the number of people that possesses a particular culture trait increases? relocation diffusion expansion diffusion contag

Anyone mind helping me ?

igneous rocks are classified based upon their: