prettygirls12 prettygirls12
  • 11-09-2021
  • History
contestada

how does a well functioning central bank benefit us?

Respuesta :

bossssjaira
bossssjaira bossssjaira
  • 11-09-2021

Answer:

It promotes the stability of the financial system, supervises and regulates the practices of financial institutions including commercial banks, works to make the systems used to conduct financial transactions safe and efficient, and advocates for consumer protections

#:)

Answer Link

Otras preguntas

Simplify the expression 2.5(8.7 + 4.6 )
How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG
Easy please quickly answer giving brainiest
g(r) = 25 – 3r g(4) =
which of the following best describes a rhetorical device?
Find the number of permutations of the letters of the word SATELLITE.
how did astronmers use technology to indenifty characteristic of the crab nebula
In this experiment, you need to examine the idea of thermal energy transfer. Using a controlled experiment, what might a good question about the variables that
Please help me answer thiss
Inequalities Would this be correct?