Iwritewithpencils Iwritewithpencils

14-05-2020
Biology

contestada

How do I use a codon wheel to solve this sequence of DNA?

AGTACCCGTTAATTAGTTGCCG

Respuesta :

andyk38105 andyk38105

14-05-2020

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

Answer Link

Otras preguntas

The buffet restaurant charges $3.25 for the first pound of chicken salad and $2.85 for each pound thereafter. If y represents the total cost and x represents th

What three variable factors determine the force of gravity between any two objects?

Jeremy is 5 years younger than his older sister. His older sister is 9 years older than his younger sister. The total of their age is 49. Write and solve an equ

how to factor x^2-2x-1

each evening, Marisol spend at least twice as much time reading as she spends doing homework. If Marisol works on her homework for 42 minutes, how much time can

If f(x)=2x+1 and g(x)=1/2(x-1), what does f(g(-4)) equal

How did people in China adapt to their environment?

How many molecules are present in the following quantity 0.250 mole of H2O

use mental math to find the value of 15/124·230/30÷230/124

Write your expression that uses partial products to multiply 8×64