jassoandrea07 jassoandrea07

16-01-2018
Mathematics

contestada

explain how to use division to find an equivalent fraction for 9/12

Respuesta :

derekhockey09 derekhockey09

18-01-2018

9 and 12 both have a common factor of 3 so you divide the fraction by 3/3 so it becomes 3/4

Answer Link

Otras preguntas

A normal six sided die is thrown once the number of outcomes in the sample is

Describe how an officer's wife would spend her time.

Brainliest and 1 graph helppp :)

quick help plzz!!!!!!!

find the slope of each line

17 Based on the graph, what is the approximate number of radioactive atoms of Isotope X that are present when 8 hours of decay has occurred? (A) 90 (B) 115 (C)

What is the nature of love, its conflicts, and its surroundings?

The figure is made by attaching semicircles to each side of an 11-ft-by-11-ft square. Find the area enclosed by the figure. Use 3.14 for pi

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAAT

Please help! I need a simile using the word shy shy as a _____