RuthDankwah5045 RuthDankwah5045
  • 12-11-2017
  • Biology
contestada

If mass cannot be created or destroyed, what happens when we burn body fat?

Respuesta :

Equanimity
Equanimity Equanimity
  • 12-11-2017
When we exercise, we are burning body fat. During exercises, the quantity of body fat cells will start to decrease. As a result, a dominant percentage of the fat molecules are exhaled as carbon dioxide.

I hope this helps!
Answer Link

Otras preguntas

Tyler began making regular deposits of a certain amount of money each month,푚, starting August 1st. The function 퐹(푚)=5푚+400models the amount of money in his ac
What is the complementary strand of DNA to the one below? AAACCGTATCCGCGGTATATCGCCGGAAT
Please help me it is very important
The invisible spectrum contains all the colors of the rainbow. A.)True B.)False
there is the question
a deer with a mass of 176 kg is running head-on towards you with a velocity of 19 m/s. you are going north. find the magnitude and direction of the deer's momen
plzz can someone tell me a little summary about el mester de juglaria in Spanish​
Describe how resources used to generate electricityhave changed over time​
I have the rest of the queachens.
What 4 traits do these two organisms share?