natb5423 natb5423

14-03-2024
Business

contestada

According to utilitarian ethics theory, what is the primary consideration when making decisions?
a) Maximizing individual profit
b) Maximizing personal happiness
c) Maximizing the greater good
d) Minimizing individual rights infringement

Respuesta :

Otras preguntas

Write about how family, school , work and community life has changed over time

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

The following lots of Commodity D were available for sale during the year. Use this information to answer the question. Beginning inventory 10 units at $60 Firs

Evaluate the expression when x = -3x²+6x+8

Ryan starts at 140 pounds, and gains two pounds per year. Carlos starts at 195 pounds, but loses three pounds per week. In how many weeks will they both weigh t

How do mechanical and chemical weathering of rocks work together?

A child has been brought to the pediatric clinic. The assessment reveals the child has a temperature of 100.9 F (38.3 C), as well as a rash that is pink and has

What is the Duolingo

Key religious duties?

how does one solve this problem? (please hurry)