drizzyizzydem816 drizzyizzydem816

15-11-2019
Physics

contestada

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

Respuesta :

15-11-2019

Explanation:

Well A-T have a complementary shape

And C-G have a complementary shape

So replace all Ts for A, and all As for Ts

Replace all Cs for Gs, and all Gs for Cs

You get"

TAACCGGTAACCTTATGGTCAGCTCCGGTGGCTCCGGAATG

Answer Link

Otras preguntas

The steps below show the incomplete solution to find the value of x for the equation 5x − 2x − 3 = −2 + 15: Step 1: 5x − 2x − 3 = −2 + 15 Step 2: 5x − 2x − 3 =

Why was Goliad seen as a solid military stronghold

second part of my question from earlier.. please help!!

What is the help about?

Kristen and Sam notice that the means of their scores for the first marking period were the same. Kristen commented that the standard deviation of her scores wa

How would you expect a drought to influence the ppf for onions (on the x-axis) and other goods and services (on the y-axis)? how would you expect the drough

what's a qat on a computer

In jury deliberations, ________ and ________ are often used to convince dissenting jurors to adopt the majority point of view.

The pituitary hormone that stimulates the interstitial cells to secrete testosterone is select one: a. gh. b. lh. c. adh. d. fsh. e. acth.

What does the word “adverse” mean in the following sentence? Adverse reactions, such as fever and headache, can occur if the medication is not taken properly.