fatumacecile
fatumacecile fatumacecile
  • 12-05-2017
  • Spanish
contestada

Change this verb from the present tense to the preterite tense. Ramón llama

Respuesta :

mw2584007
mw2584007 mw2584007
  • 12-05-2017
llamar a Ramon would be in present tense
Answer Link
annaaaaaa11
annaaaaaa11 annaaaaaa11
  • 15-05-2017
Ramon llamaron ??? Idk
Answer Link

Otras preguntas

Which is the abbreviation for the hormone released by the anterior pituitary gland that stimulates the thyroid gland?
Which molecule is secreted from the peritubular capillary network into the convoluted tubules?
how to make a balanced chemical equation
The situation analysis of an advertising plan includes historical context as well as evaluation of the industry, the market, and the competition.
what is the average rate of change of f over the interval -1 is less than or equal to x less than or equal to 1?
By age 65, what percentage of adults are grandparents? 75 80 85 90
Janice has three times as many dimes as nickels. If the total value of the money is $9.10, how many of each types of coin does she have? Please show work.
What is the relationship between dna replication and the s phase of the cell cycle?
Christa works at a fast food restaurant making $7.75 per hour. She wants to gross $400 this month, and she is scheduled to work 40 hours. Will she earn her goal
PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se