splTaghMePaytre splTaghMePaytre

13-04-2017
History

contestada

Why did the empire state building get built?

Respuesta :

zoemezz zoemezz

13-04-2017

John Jacobs Rascob (I think?) built the Empire state building purely because he was competing with other entrepreneurs to construct the tallest in the world!
What an extraordinary fact, don't you think?
Hope this helps!
- Z

Answer Link

Otras preguntas

If a person showed up in the emergency room showing signs of tetanus, which of the following would be the most appropriate therapy for him in the emergency room

A muscle cramp is most likely due to lack of A) ATP. B) ADP. C) actin. D) myosin. E) acetylcholine.

Positive numbers are located to the left of zero on the number line. True False

Someone please help me with #18

Area of the shaded segment=

List, number, and describe the six general classes of pathogens.

Replicate the following DNA strand: 5' ATTGCGAACTGCGAGGACTTC 3'

Compared to skeletal muscle, smooth muscle A) contracts faster B) relaxes faster. C) contracts and relaxes faster. D) contracts faster and relaxes more slow

The primary androgen is _____________

The marketing specialist earned $12.75 per hour and worked 38 hours per week. If her total deductions were 35% what was the amount deduted from her pay?