kaylamcfadden0654 kaylamcfadden0654

15-09-2022
English

contestada

Which student is most clearly using evidence to support a conclusion?
OA. Edgar
OB. Maria
C. Riku
OD. Victor

Respuesta :

mehakb161 mehakb161

15-09-2022

Answer is option b Maria

Answer Link

Otras preguntas

You discover an organism that has scaly skin and is aquatic but returns to the land to reproduce. what else would you expect to find in this organism?

Please help me fill in this table.

The change in the average price of a gallon of milk from 2011 to 2013 is shown in the chart below. Year: Price Change: 2011 -0.57 20

what is this simplified?

How many blocks with dimensions are needed to fill the gap in the prism?

In 2003 u.s. soldiers abused iraqi prisoners held at abu ghraib, 20 miles west of baghdad. the prisoners were stripped, made to wear bags over their heads, and

What is the appropriate personal pronoun for the bold word in the following sentence? Gina wrapped the gift in blue paper.

What do Lord Montague and Benvolio have to say about Romeo's current behavior? (Romeo and Juliet Act 1, Scene 1)

You make picture frames to sell at the flea market; you spent $46 on supplies and you want to sell the frames for $8.50 each. How many frames would you need to

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg