romeoxrios romeoxrios
  • 15-07-2022
  • Business
contestada


Which of the following is true regarding a market value adjusted annuity?

Respuesta :

jsnsbsjs
jsnsbsjs jsnsbsjs
  • 15-07-2022

Answer:

A tool used by an annuity issuer to reduce its exposure to interest rate risk

Answer Link

Otras preguntas

What is the complementary strand of DNA to the one below? AAACCGTATCCGCGGTATATCGCCGGAAT
How would you write the equation with a slope of 2/3 and a y-intercept of -3
A painter is painting the outside of a house. Describe how the paint could become a point source of air, soil, and water pollution. Include one example for each
I really don’t know the answer can you please help me thank you
what percent of Egypt population lives within 12 miles of the Neil river?
The graph of which equation is parallel to the line in the graph above?
Between large plantations in the Chesapeake region were: O A. Native American villages. O B. French trading posts. O c. small farms. O D. army barracks. SUBMIT
Guys I Dont speak or Know spanish can u help me its just two simple questions
what was the link between the 1905 and 1917 Revolution essay​
3. The help meeee hurry plsssssssssorganism in the photo is a daphnia, or water flea. Daphnia are tiny aquatic organisms that live in most freshwater habitats.