thatonechild
thatonechild thatonechild
  • 15-07-2022
  • Biology
contestada

What is the replicated DNA sequence for GGC GAG AAT GAA ACT ATT TGT AGC

Respuesta :

ariahuds8154 ariahuds8154
  • 15-07-2022

Answer:

ccgctcttactttgataaacatcg

Answer Link

Otras preguntas

Simplify the expression. Write the answer using scientific notation. Astronomers measure large distances in light-years. One light-year is the distance that l
An alternator usually has ____Windings that require a total of ___ diodes A. Two; four B. Two; five C. Three; four D. Three;six E. Four; five
Select the decimal number that is equivalent to the mixed number 94 79/100 .
I have some of these answers trying to see if I got them right
You are attending to a 26-year-old female who is 34 weeks pregnant with her first child. your patient has been having lower abdominal pains and cramping for the
A. What is temperature really a measure of?
Help Me! WITH THIS HARD PROBLEM
When humans control breeding of other organisms to favor certain traits, it is referred to as __________. natural selection artificial selection human selection
Read the speech excerpt below and answer the question. Looking for ways to save money? You can save money and bond in a big way if you groom your dog yourself.
Can you guys help me