mhakamatilda mhakamatilda
  • 14-06-2022
  • Mathematics
contestada

Three integers have a mean of 10, a median of 14 and a range of 12.
Find the three integers.

Respuesta :

colinspurdle colinspurdle
  • 15-06-2022
Let the numbers be a, b and c in order of size.
b is 14 as it is in the middle
c - a = 12 so c = a + 12
(a + b + c)/3 = 10
a + b + c = 30
a + 14 + (a + 12) = 30
2a + 26 = 30
2a = 30 - 26 = 4
a = 2
c = 2 + 12 = 14
So the three numbers are 2, 14 and 14
Answer Link

Otras preguntas

What do Hondurans say to each other when passing on the street
What are the x-intercept and they-intercept of the graph of : y=1/4x+8?x-intercept: y-intercept
how far is Asia from Africa?
what action does caliban suggest when he discusses killing Prospero stephano and trinculo
What's the answer to this
infer about root system mean
Can a paragraph discuss more than one topic
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
Buddy Rich has appeared in Hollywood films Symphony of Swing (1939) Ship Ahoy (1942) Louis Armstrong How’s About It (1943) What is wrong with the passage?
If one gallon of paint covers 825 sq. ft., how much paint is needed to cover 2640 sq. ft. ?