2006rhi
2006rhi 2006rhi
  • 14-05-2022
  • Mathematics
contestada

Find y.
Do not round your answer.
9 in
у
5 in
Х
19 in
y = [ ? ] in
=

Find y Do not round your answer 9 in у 5 in Х 19 in y in class=

Respuesta :

wavhudiglodine
wavhudiglodine wavhudiglodine
  • 14-05-2022

Answer:

33y

Step-by-step explanation:

step 1. 9y+5y+9y=33y

Answer Link

Otras preguntas

Pls I need this right away if you answer I’ll mark you the brainliest. Pls put how you got your answer too!
How did Paul help shape the beliefs of early Christianity? Paul organized the new Christian Bible. Paul sent letters to new churches to advise them. Paul became
s were afraid that more tribes would take away some of their gambling business I don’t get it
24) What is the narrator's main purpose in this passage? astian music A) to describe how to become a composer Eliminate B) to convince the reader to be more mus
Is the below sequence DNA or RNA? How do you know? GTTTACAGGCGGCGCAATATCTGATCG
why are the group 17 elements the most reactive of the nonmetal elements a)they are the biggest elements b)they have the fewest electrons c)they are located on
In the modern political system, which of the following statements accurately portrays a major disagreement between Democrats and Republicans? A. Democrats favor
What occurred just before the start of the Cenozoic era? a meteor impact the ice age mammal dominance plants and animals first colonize on land
PLEASE HELP ASAP! Will give BRAINLIEST! Please answer correctly! No guessing!
Samantha took a survey of the students in her grade to see how many are likely to join a knitting club if she starts one. She surveyed 24 students, and 12 said