steameddragon52 steameddragon52

14-02-2022
English

contestada

Select the suffix you would find in a word indicating a person who.

Dom
Ism
Ist
Ology

Respuesta :

maryammaster maryammaster

14-02-2022

Answer:

I think is Ist

Explanation:

I hope I helped

Answer Link

Otras preguntas

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se

A car travels 237 miles in the same time that a motorcycle travels 207 miles. If the car's speed is 10 miles per hour more than the motorcycle's, find the spe

What is the connotative effect of the word pale, which is repeated so frequently throughout this poem?

Preventing complications and loss of function are goals for residents with which type of disease/disorder?

What is one reason that people want to minimize costs ? A. Costs are often bad things that people don’t want to accept. B. Costs always involve spending money

Anyone know how to solve this?? Number 5!!

how do you find the area of the shaded figure

Choose one selection from the list below that you think is most suspenseful and frightening persuade your reader why it is the scariest and support your argumen

Find the difference sqrt 20- sqrt 80

What did the United States argue for at the Yalta conference?