may7ahsg may7ahsg

12-02-2022
Mathematics

contestada

Are you clever enough to earn 100 points?
What would be the answer on the graph?

Are you clever enough to earn 100 points What would be the answer on the graph class=

Respuesta :

semsee45 semsee45

12-02-2022

Answer:

(8, 9) and (12, 3)

Step-by-step explanation:

The ends of the line would be (8, 9) and (12, 3)

Because the scale factor is negative, the guide lines go through the centre of enlargement rather than from it.

Ver imagen semsee45

Answer Link

Otras preguntas

Expand the polynomial (x + y)7 and write the coefficients of the terms.

How mitochondrial failure is involved in shallow breathing, shivering, and Weak pulse.

Determine which integer in the solution set will make the equation true

Use the given information to write and solve a system of linear equations to find the values of x and y.

Given that events A and B are independent with P(A) = 0.42 and P(B) = 0.05, determine the value of P(AN B), rounding to the nearest thousandth, if necessary.

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated

why the trojan war was fought?

How do I solve this?

The ABC Corporation is considering opening an office in a new market area that would allow it to increase its annual sales by $2.6 million. The cost of goods so

I need help with this by tonight pls or I will not get an updated grade it's hard for me to understand this