25roev05 25roev05

11-02-2022
Biology

contestada

What is the mRNA transcript if the complementary DNA is TCTGAG?

Respuesta :

10818570 10818570

11-02-2022

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

Answer Link

Otras preguntas

What is the minimum value an eccentricity can be?

The ratio of women to men in the theater was 5 to 4. If there are 1200 women, how many men were there?

The product of two consecutive odd integers is 77 more than twice the larger integer.find the integers.

list two ways that American Indians and European colonists were allies

Put these in order from least to greatest 6.4 kg 640 g 600,000 mg

what is the function of flagella??

Explain why animals must eat food, but plants do not have to.

What is the answer to 7n-2(n+5)< 3n-16

what is the function of flagella??

A park is in the shape of a rectangle 2 miles long and 1.5 miles wide. How much shorter if you walk diaganolly across the park rather than along two sides?