alizahyasir13 alizahyasir13
  • 13-06-2021
  • Mathematics
contestada

how can you evaluate 36^1/2

Respuesta :

roslynrodriguez24
roslynrodriguez24 roslynrodriguez24
  • 13-06-2021

Answer:

6

Step-by-step explanation:

Answer Link
jimthompson5910 jimthompson5910
  • 13-06-2021

Answer:  6

======================================================

Explanation:

Exponents of 1/2 are the same as square roots

[tex]36^{1/2} = \sqrt{36} = 6[/tex]

If the exponent was say 1/3, then we'd be taking a cube root

[tex]36^{1/3} = \sqrt[3]{36}[/tex]

and this is what a fourth root would look like

[tex]36^{1/4} = \sqrt[4]{36}[/tex]

and so on

Answer Link

Otras preguntas

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated
what is the average daily balance of your saving account on april 30,2020 if you deposit rs 1000 on February 1 and rs 2000 on march 1 and withdraw rs 500 on apr
Kayak requires a minimum cash balance of $40,000 at each month-end. Loans taken to meet this requirement charge 1%, interest per month, paid at each month-end.
2) a: b is 2:5 and b: c is 3:8 Work out a:c Give your answer in its simplest form.
x^2-12x+43 i need some help with this maths question
g(x+1)=3x + 1 find g(2)
Please, help me<3 123
What is 7,899 to the nearest thousand
Father of Texas --- What duties did Stephen F. Austin perform as the leader of his colony? ;​
Some claim Newfs are descended from the 10big bear dogs who were rumored to be Viking companions.