eberkenbile719oy8iou
eberkenbile719oy8iou eberkenbile719oy8iou
  • 13-05-2021
  • Mathematics
contestada

15th term of the sequence an = -3n+50​

Respuesta :

jgillenwater
jgillenwater jgillenwater
  • 13-05-2021

Answer:

The 15th term is 8

Step-by-step explanation:

Answer Link

Otras preguntas

There are 8 oranges, 5 apples, and 6 bananas In the fruit basket. -Bob says the ratios of apples to bananas is 5:6 -Rob says the ratios of bananas to apples i
PLEASE ANSWER ASAP!!! Look at the first sentence of the passage. Dogs have provided many services for people over the years. What relationship does this senten
Ajar contains 2 red marbles, 3 blue marbles, and 1 green marble. What is the probability of selecting a blue or green marble? write answer in fraction
An architect is allowed 56 square yards of floor space to add a small bedroom to a house. because of the rooms design in relation to the existing structure, the
what is the mRNA in TACCGGATGCCAGATCAAATC?
what is 3456 x 3 hundreds
Here it is please make sure it’s right
Click on the link for Article I, Section 1. What two parts does Congress have?
How does the first-person point of view of the speaker contribute to the meaning of the poem Urania
True or False: Limiting factors can help within an ecosystem by preventing populations from becoming too large.