kendallscats kendallscats

12-03-2021
Mathematics

contestada

Hi! I just wanted to say hello and ask this question for easy points! 5-1=?

Respuesta :

astrobrooklyn astrobrooklyn

12-03-2021

Answer:

its horseradish

Step-by-step explanation:

Answer Link

YaBoyHayden YaBoyHayden

12-03-2021

4 :)))))))))))) have a great day

Answer Link

Otras preguntas

The Punic Wars began in 264 B.C. and ended in 146 B.C. How long did the Punic Wars last??

how do you divide? because i need to know fast

Replicate the following DNA strand: 5' ATTGCGAACTGCGAGGACTTC 3'

the vertex of a parabola is (3, 2). They second point on the parabola is (1, 7). Which point is also on the parabola?a.(-1,7)b.(3,7)c.(5,7)d.(3,-2)

Which of the following is an accepted theory for the evolution of amphibians? food supply was great on land disease in the oceans internal sexual reproduction e

The difference between the present value of future cash inflows and the present value of future cash outflows of an investment project is the:

What are the coordinates of the points (2,-3) after a counter clockwise rotation of 90 about the Origin?

The roles of the neuroglial cells, includes a. Lining cavities b. formation of blood brain barrier c. Phagocytosis of parhogens d. myelination e. all of the

In FKR, which side is included between F and R

Which one of the following is not an assumption of the EOQ model? Decisions for one item can be made independently of decisions made for other items. There is n