meme900 meme900
  • 14-02-2021
  • Mathematics
contestada

Find the area of the figure by subtraction.

Find the area of the figure by subtraction class=

Respuesta :

xenia168
xenia168 xenia168
  • 14-02-2021

Answer:

56

Step-by-step explanation:

Ver imagen xenia168
Answer Link

Otras preguntas

write a composition on the topic ‘A World Without Borders’ in 150 words.
Which of the following is an example of organ reduction that most birds have? a. No urinary bladder b. small kidneys c. No pancreas d. Small stomach
What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3' a) 5' CTGTATCCCAGACGGATATAACT 3' b) 5' TCAATATACCGTCTGGGTA
A car can travel 300 miles on 10 gallons of gas. The ratio is 300 miles to 10 gallons.Miles 0 - 0 Gallons30. 30 - 160. 60 - 2 90 - 3 120 -
In hunter-gatherer societies, the shaman or medicine man (or woman) was important not only for understanding what we now call medicine, but also because a. he
Which of the following is the correct formula for nitrous acid? a) HNO b) HN2O c) N2O d) HNO2 e) HNO3
Express each ratio as a fraction in simplest form 1. 13 oranges to 26 apples 2. 12 inches to 3 feet
cual es otra palabra para decir “una llamada gratis’?
How much energy is required to raise 10 grams of water by 10 degrees Celsius? (in Joules)
A graded potential always leads to an action potential a. True b. False