john807060 john807060

16-01-2021
Health

contestada

Branliest to correct answer please only answer if you know for sure no guessing :)

Branliest to correct answer please only answer if you know for sure no guessing class=

Respuesta :

mythicalthetiger mythicalthetiger

16-01-2021

The first answer is correct :)

Answer Link

laneyconn laneyconn

16-01-2021

Answer a is correct!! ;)

Answer Link

Otras preguntas

if u cut down a forest for a housing development what can you predict will happen to the overall health and sustainability of the ecosystem over time?

Does anyone know what this answer this

Which of the following is an incorrect example for adaptation in plants? A The green color of needles and leaves because the green reflecting chlorophyll facili

List five “Homes” or “Palaces” that are mentioned in anthem

Which plant travels the fastest

Which option best completes the diagram? Clarence Gideon is convicted of a felony in Florida after being refused a lawyer. The Supreme Court rules that states m

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’ What is the cellular process shown (mRNA to amino acids?) where in the cell does this process take place?

A summary of a plot is called? An excerpt A retraction A quote The main idea

Four gardeners record the weight in pounds of five pumpkins they grew.which statement about the weights of the pumpkins is true

Most of the slaves that eventually worked the sugar plantations in the Americas were brought from __________. A. China B. Africa C. Europe D. India it's Afr