colleengreenaway2003 colleengreenaway2003

16-01-2021
Mathematics

contestada

solve the equation by completing the square. (step by step please)

4x(x + 6) = -40

Respuesta :

16-01-2021

Answer:

4(x+3)²+4

Step-by-step explanation:

4x²+24x+40=0

using the equation above

a:4 b:24 c:40

4(x+(24÷2x4))² + (40-(24²÷4x4))

4(x+3)²+(40-36)

4(x+3)²+4

Ver imagen SAH04

Answer Link

Otras preguntas

If there are 14 people sitting evenly spaced around a circle which person is directly across from the 2nd person?

How many moles of oxygen are produced by decomposing 40.5 g of h2o2 (molar mass = 34.0 g/mol) according to the equation:h2o2 --> h2o + o2 (unbalanced)?

After the end of ww1 and before ww2 began many people in Russia were unhappy with what/10957789/641dc8ba?utm_source=registration

The inciting incident in the book can best be described as the point in the story at which A. Taylor's mother abandons her. B. Taylor is handed a baby in a ro

What is the article New York Times about?

5) This is the arrangement where buyers and sellers learn information from one another and voluntarily exchange goods, services and money.

Which sentences use the same type of figurative language as the underlined phrase in the paragraph? Rattlesnakes are quick as lightning when they are angry. Bu

How were the Japanese able to surprise the US at Pearl Harbor?

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the

what surprising information does annie's father give her about his past?