Seudónimo Seudónimo
  • 14-01-2021
  • Mathematics
contestada

Please help quickly (math)

Please help quickly math class=
Please help quickly math class=

Respuesta :

jesusm1
jesusm1 jesusm1
  • 14-01-2021

Answer:

  • We are asked for the angle of the translated figure ACB prime
  • When asked in that manner they want "C'"
  • Hence A'C'B'= 46 degree
Answer Link

Otras preguntas

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAAT
This is not a really need help with question but you may answer it What does Hola Mucho gusto mean in English? What does Esta bien mean in English? What does
Find 3 ratios that equal to 7:3
A scalene triangle has an angle that measures 47∘ and a second angle that measures 88∘. What is the measure of the third angle?
You want to change your cell phone plan and call the company to discuss options
What are the growth/decay factors and rates for the following functions? a. y=1000(1.03)x b. f(x)=200(0.8)x
The mineral quartz has a chemical formula of SiO2. What is the formal name for this compound?
A traffic camera sits on top of a tower that has a height of 39 ft. The angles of depression of a car on a straight road at the same level as that of the base o
The cash price for a stereo system is $900. You choose to buy it on credit and give a $100 down payment, and the balance due is 24 equal payments of $42. Instal
What was a challenge for the Europeans who attempted to create the first printing press