grannyghetto92
grannyghetto92 grannyghetto92
  • 12-01-2021
  • Arts
contestada

Exhibit parental care *

A. Monotremes
B. Marsupials
C. Placental mammals

Respuesta :

hanneyc
hanneyc hanneyc
  • 12-01-2021

Answer:

Monotremes- Mammals that Lay Eggs

Marsupials- Hairy, Warm Blooded, and Produce Milk. Give Birth Quite Early and Rely Less on the Nourishment of the  Placenta

Placental Mammals- Substances are Passed from the Mother to the Fetus so that it can Stay in the Womb Longer

Explanation:

Answer Link
h3kravenajah73
h3kravenajah73 h3kravenajah73
  • 02-03-2021
BBbbbbbbbbbbbbbbbb is the answer
Answer Link

Otras preguntas

if the dissipated power between a and b equal 210 watt then VB equal​
the mysteries of udulpho essays
what is einsteins theory of relativity?
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein
which process is suitable to yield high quality ethanol greater than 95%​
Why should the US go to or join a war?
I also need to know what m∠cdb is
what an expression for 8 times b
What type of ions are commonly formed from halogens​
Can someone please solve this x + 7 = 12