713sergio 713sergio

15-12-2020
Biology

contestada

If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

Respuesta :

peppapig200 peppapig200

15-12-2020

UACCGCUCCGCCGCUCGACAAUACC

Answer Link

Otras preguntas

which sentence uses the passive voice?A. John searched for a job.B. lies destroy friendship.C. the rain continued until dawn.D. the tree was planted by Mary.

How does Mendel’s work demonstrate support for the concepts of dominant and recessive alleles?

All of the following processes require the cell to use ATP energy, EXCEPT A) endocytosis. B) active transport. C) passive transport. D) the sodium-potass

what word looks the same when read upside down

How is the modern Department of Defense different from the old Department of War? It is a cabinet department and not an independent executive agency. It was no

Compare the chromosomes in the two daughter cells produced by Meiosis I. Do these chromosomes have the same alleles? How do you know?

So I have this equation: 36x^2-121y^2=49 Which I rearranged to 36x^2/49-121y^2/49=1 So I want to go from here and find the eccentricity,foci,asymptotes etc... B

what is 10-(3×2^2-23)/(1+10^2)-2^2×5^2 in simplest form

Match the terms to their correct examples or descriptions. 1. body language 2. tone and body language 3. resolving conflict 4. good way to handle conflict 5

How do you solve 2 (x-3)=2