Gabspinklif Gabspinklif

15-10-2016
Arts

contestada

Opera seria puts a greater emphasis on the experienced and masterful singer.

Respuesta :

Greenleafable Greenleafable

28-10-2016

It is true that opera seria puts a greater emphasis on the experienced and masterful singer. It is very stylized and creates situations where the singer gains a degree of stardom.

Answer Link

schlomeren14 schlomeren14

18-02-2020

Answer:

True.

Explanation:

Common Sense.

Answer Link

Otras preguntas

The triangle below is equilateral. Find the length of side x in simplist radical form with a rational denominator.

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

On page 220, Anne writes that “[no] one must know that my heart and mind are constantly at war with each other.” What does she mean by this? Do you notice this

how do you start square roots in mathmaticals?

What is the negation of "Everybody loves somebody sometime"

Find the y-intercept of the quadratic function: g(x)=2(x+3)^2+8

Please help??????????

please solve this question

A table is on sale for $589, which is 24% less than the regular price. What is the regular price?

Apollo Enterprises has been awarded an insurance settlement of $6,000 at the end of each 6 month period for the next 12 years. calculate how much (in $) the ins