12-11-2020
History

contestada

1. Which action was taken as a result of the Fredonian Rebellion?

Respuesta :

Аноним Аноним

12-11-2020

Answer:

the rebellion led mexican president guadalupe victoria to increased the military presence in the area.

Explanation:

Answer Link

Otras preguntas

A ball is shot from a cannon into the air with an upward velocity of 65 ft/sec. The equation that gives the height (h) of the ball at any time (t) is: h(t)= -1

A sphere has a diameter of 3 ft. What is the volume

Find the percent of change. Round to the nearest tenth of a percent if necessary. Item 8 Question 1 Identify the percent of change as an increase or a decrease.

Cycloalkanes are (saturated/unsaturated) compounds. (which one)

Please help me with this question! Thank You!

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to d

Suppose that Darnell, an economist from an AM talk radio program, and Eleanor, an economist from a school of industrial relations, are arguing over government b

Find the quotient. 715 / 9 =

Suppose there are 50 couples with the same blood type and hemoglobin genotypes. They live on a small, isolated Pacific island on which very few mosquitoes have

he number negative eight is to the right of negative ten on the number line. Which choice expresses this fact in symbols? A) -8 > -10 B) -8 < -10 C) -8