Seudónimo Seudónimo

15-10-2020
Biology

contestada

Identify the structure labeled A in the diagram?

A. Base
B. Phosphate
C. Sugar
D. Protein

Identify the structure labeled A in the diagram A Base B Phosphate C Sugar D Protein class=

Respuesta :

aymanimtiaz04 aymanimtiaz04

15-10-2020

Answer:

PHOSPHATE

Explanation:

Answer Link

greenelf greenelf

15-10-2020

THE ANSWER IS PHOSPHATE

Answer Link

Otras preguntas

Marketing increases firm value by accelerating cash flows. a) True b) False

Volume of shape below

One of the impacts of poverty is __________, which involved an omission of appropriate care rather than the commission of a hurtful act. The role of poverty sho

Which of the following statements about intermolecular forces is CORRECT? I. All molecules have dispersion forces II. All molecules with H bonds have hydrogen b

Qué se forma cuando se encuentran dos vocales fuertes

n the United States and most other countries, the source of capital on which firms most heavily rely is ________. The bird-minus-in-minus-the-minus-hand argum

Suppose in each PSW entry in the interrupt vector the mode bit is user mode. Will this create a problem in processing an interrupt? Explain. a) True b) False

Which enzyme is not a regulatory step in glycolysis?A) Phosphofructose kinaseB) Phosphoglycerate kinaseC) Pyruvate kinaseD) Hexokinase

Quilcene Oysteria farms and sells oysters in the Pacific Northwest. The company harvested and sold 7,300 pounds of oysters in August. The company's flexible bud

Replicate the following gene strand, and then transcribe the template strand:GTTAATGGCCATGATGGCTTTGTGATTAAGC .Translate the mRNA from above using single letter