haydenrosejackson1 haydenrosejackson1

15-10-2020
Biology

contestada

What is the complementary strand for this segment of DNA? I'll give u 15 point pls answer

What is the complementary strand for this segment of DNA Ill give u 15 point pls answer class=

Respuesta :

zayveionbrown zayveionbrown

15-10-2020

I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC

Answer Link

Otras preguntas

5(?+3)+?(6 + 3)=108.

In class one day, a student heard the teacher say that "like dissolves like." To test this theory, she performed the following experiment: Four 250 mL beakers c

I need someone to create a new Soliloquy for Romeo and juliet

Help me with my Spanish 1 homework

7. Some delegates to the Constitutional Convention were in favor of the indirect election of members of the federal government because they felt that this would

Maribelle uses x yards of material yo make a quilt. A customer requests 5 quilts that are 20% larger than the normal pattern. Write an expression to represent t

The intensive labor that expanded Jamestown’s economy was carried out largely by ________.

Write the slope-intercept equation of the line through the coordinates (4,5) and (-4,-3).

A vehicle travels on the highway with the windows closed, in an intense summer in Brazil. The driver is in doubt whether to turn on the car's air conditioning o

Which number completes the sequence? Type in your answer. 1, 2, 4, 7, 12, 19, 30, ?