emilygutierrez1222 emilygutierrez1222

12-10-2020
Geography

contestada

According to the map, which location is closest to the North Pole?

-Denver, Colorado

-Fargo, North Dakota

-Houston, Texas

-Boston, Massachusetts

According to the map which location is closest to the North PoleDenver ColoradoFargo North DakotaHouston TexasBoston Massachusetts class=

Respuesta :

ijimmyjohn ijimmyjohn

12-10-2020

I'm going to assume Fargo, I may be wrong, correct me if so

Answer Link

jadeandlauren jadeandlauren

12-10-2020

Definitely Fargo, North Dakota

Answer Link

Otras preguntas

Explain how eutrophication can change an aquatic ecosystem into a land ecosystem?

which of these supreme court cases is an example of the government protecting the rights of an individual? a) plessy v ferguson b) bush v gore c) texas v johnso

Llena el espacio con la palabra correcta. Word Bank: me, te, le, nos, les. El _________botones a0 dice la información. (a ellas

My teacher marked this wrong on my test, but I don't know where I messed up!

Which of the following can be used to visually represent information similar to diagrams? A. Format Painter B. Headings C. Smart Art D. Clip Art

what was the importance of the victory over the british army at Sullivan's island?

Why did the partition of Africa create artificial boundaries?

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3

The slope of a line is 2, and the y-intercept is 0. What is the equation of the line written in slope-intercept form?

Show that sec^2x+csc^2x=sec^2xcsc^2x