cooperthic4you cooperthic4you

14-09-2020
Mathematics

contestada

the temp dropped 13 digress Fahrenheit in 7 hours. the final temp is -2 Fahrenheit. what was the starting temp. adding integers

Respuesta :

TSanders12 TSanders12

14-09-2020

The starting temp is 11 degrees

Answer Link

Otras preguntas

which graph shows the rule: output = 5 times the input ? explain please!!

What is the primary goal of having children attend preschool in japan and most of europe?

Problems faced by labor unions included:

After the hairdresser Jenny had 27 centimeters cut off her hair how many decimeters of hair did jenny have cut off

The Emergency Medical Treatment and Active Labor Act is a federal law that makes sure that patients receive emergency medical care regardless of their ability t

Why are lamarck's ideas called scientific hypotheses and not scientific theories?

which living thing is a typical lake inhabitant apex

Consider the sequence of steps to solve the equation: 3(x − 4) + 5x = 9x − 36 Given ⇒ 3(x − 4) + 5x = 9x − 36 Step 1 ⇒ 3x − 12 + 5x = 9x − 36 Step 2 ⇒ 3x + 5x −

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se

For a material that contains n atoms, how many electron states will there be in a p band