lfsummers2006 lfsummers2006

12-09-2020
Mathematics

contestada

Find the value of each variable (x in this case)

Find the value of each variable x in this case class=

Respuesta :

Cytokine Cytokine

12-09-2020

2x and 4x + 108 are supplementary angles and that means they add up to 180 degrees.

2x + 4x + 108 = 180

Combine like terms

6x + 108 = 180

Subtract 108 from both sides.

6x = 72

Divide both sides by 6

x = 12

Answer Link

Otras preguntas

A spinner is numbered from 1 through 10 with each number equally likely to occur. what is the probability of obtaining a number less than 4 or greater than 7 in

What crime did jack commit in the musical Newsies?

PLS HELP ME ASAP ON 5! THANK YOU SO MUCH!! (Read direction carefully pls ^^) (Brainliest will be given) (Random answers gets moderated.)

The answer choices are A.Hydrogen B. ionic C.Metallic D.Covalent.

Which of the following correlation coefficients indicate a weak positive correlation? A) -0.1 B) 0 C) 0.6

Which statement is false? A. A parallelogram is a rectangle if and only if its diagonals are congruent. B. A parallelogram is a rhombus if and only if its diago

Please help with graph question

Which describes the structure of a water molecule, H2O? It has two polar single bonds and a bent shape. It has two nonpolar single bonds and a bent shape. It ha

PLEASE HELP WILL GIVE BRAINLIEST

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg