Seudónimo Seudónimo
  • 14-04-2020
  • Mathematics
contestada

I need so much help!!!!

I need so much help class=

Respuesta :

annalouise99 annalouise99
  • 14-04-2020

Answer:

38.5

Step-by-step explanation:

1:5.5

7:x

x=7times 5.5

x=38.5

7:38.5

Answer Link
teaganmiller
teaganmiller teaganmiller
  • 14-04-2020
the answer is 38.5.
Answer Link

Otras preguntas

ad is tangent to circle o at d. find ab. round to the nearest tenth if necessary
Which type loan requires you to pay interest accumulated during college
If an object is propelled upward from a height of s feet at an initial veloc​ity of v feet per second, then its height h after t seconds is given by the equatio
I need this asap, and if I don't get this right. There will be no anime for me .Match each word from Column A with the correct definition from Column B. Column
Emotional responses to a traumatic event are most directly under the control of the
Eric is more likely than his sister to be negatively affected by x-linked disorders because __________.
PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se
if you are creating a web page, what are 2 file formats you can use?
Having trouble with this one can someone teach me how to find the slope in this question. Try to help me learn it aswell. Its in the file down below (Find the S
who is in charge in a command enonomy