HeyDare HeyDare
  • 13-07-2016
  • Mathematics
contestada

Hi can you help me on this one?


2/3 x 4 =

Respuesta :

Romeo2468 Romeo2468
  • 13-07-2016
the answer is 2.666 0r just 2

Answer Link

Otras preguntas

Why might it be a problem for fish and other organisms in a pond if all the algae died?
What is the appropriate personal pronoun for the bold word in the following sentence? Gina wrapped the gift in blue paper.
In Athens the practice of a trial by __was started and allowed the accused to speak for himself ? A. 10 generals B.council of 500 C.jury D.none of the above
What was the first living cells to evolve on earth?
Which hormone plays a central role in determining the rate of sodium reabsorption and potassium secretion? which hormone plays a central role in determining the
Which pollutant would you expect to be present in low concentrations during morning rush hour in a large city like Chicago? a. volatile organic compounds b. nit
Which feature involves compression? Select the three correct answers. A. Normal faults B. Reverse faults C. Anticlines D. Mono lines E. Folded mountains c
In Georgia, who is MOST responsible for enforcing the laws of the state? A) the Governor B) the State Senate C) the Supreme Court D) the State House of Repre
which statement best describes the process that produced the ending populations of moths
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg