thomasnast thomasnast

14-01-2020
Chemistry

contestada

a population includes all the different species of organisms in a specific place at a specific time

true

false

Respuesta :

jnguyen07 jnguyen07

14-01-2020

Answer:

False

Explanation:

Population has the same species while community has different species.

Answer Link

jacobrpritchard6789 jacobrpritchard6789

14-01-2020

True, it is true bc 2+2=4-1=3 quick math

Answer Link

Otras preguntas

7 plus what equals 23

Each month for 6 months, Kelsey completes 5 paintings. How many more paintings does she need to complete before she has completed 38 paintings?

Select inductive reasoning, deductive reasoning, or neither. If 5x + 7 = 12, then x = 1. A. Inductive reasoning B. Deductive reasoning C. neither

What areas of life and society changed so radically during the Classical period that this time came to be known as the "Age of Revolution?" politics philosophy

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3

A chemical sequence of DNA, or ___, determines a trait of an organism.

If you want to go to the party with us, send me _________ text. the (ningún artículo) an a

A dog owner is told by the veterinarian that his dog, Max, is overweight and needs to lose 4 to 5 pounds in order to live a healthy life. The dog weighs 126 pou

An airplane flew 2,400 miles in 4 hours.

Gravity causes mass to accelerate because gravity is a _____. a. mass b. force c. constant d. type of energy