matts1234455dfdfr matts1234455dfdfr

14-11-2019
History

contestada

african americans contribution to society

Respuesta :

youngjaekwon youngjaekwon

14-11-2019

Answer:

j a z z

have a good day mate

Answer Link

arielpaige2003 arielpaige2003

14-11-2019

Answer:

many African americans contributed there culture and there ideas such as the tarffic light , automatic elevator door and etc.

Answer Link

Otras preguntas

Suppose you are the owner of a picture frame store and your current fixed costs total $50,000 (real estate taxes, interest on a bank loan, etc.). In addition, y

How does an inclined plane affect the effort needed to move a load vertically?

Look at these situations that students sometimes face at school. Sort them by whether they are challenges or triumphs. gets help from peer mediators performs i

The ____________________ is what an organism looks like.

A and B are independent events. P(A)=0.40 and P(B)=0.30. what is P(A and B)?

Why is trade a cause of the renaissance?

Find the area of the figure. Use 3.14 for A.

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3' a) 5' CTGTATCCCAGACGGATATAACT 3' b) 5' TCAATATACCGTCTGGGTA

Selma, an elderly widow, gives her young neighbor, Steven, written power of attorney. This means that Steven now: A. is an undisclosed principal. B. has implied

Roger wants to have 400 copies of his resume printed. His local print shop charges $21.50 for the first 200 copies and $10 for every 100 additional copies. How