conceited1234 conceited1234
  • 12-11-2019
  • Chemistry
contestada

Most likely to break apart a rock

Respuesta :

joemamma27 joemamma27
  • 12-11-2019
Sherk because he’s a big boy
Answer Link
hayleeweb
hayleeweb hayleeweb
  • 12-11-2019
Well if you hit a bigger rock on it, it will most likely break
Answer Link

Otras preguntas

#19 The Native Americans shown in this photo were subjected to “Americanization.” What was Americanization? A. an attack on Native American beliefs and practice
What is the value of x? Enter your answer in the box. x = __
Natural gas _____. is mostly methane is a renewable resource releases nitrogen oxide when burned produces 75 percent of the world's electricity
Determine the Ka value of propanoic acid if it is found that 2.95x10-3 M of each conjugate exists when a 0.65 M solution is made.
Translate the following words into English. el ruido extraño a) the strange noise b) the extreme sound c) the strange ruins d) the extra step
Select the correct answer from each drop-down menu.
How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10
In the United States a bale of cotton weighs 500 pounds. How many kilograms does a bale weigh?
Instruments affecting real estate are recorded with the County Clerk's office in the county where the property is located in order to:
Consider the role of race and religion in the genocides discussed.