kingward1239 kingward1239
  • 11-05-2016
  • Mathematics
contestada

mixed number is equivalent to the improper fraction 29/9

Respuesta :

angelanna11 angelanna11
  • 12-05-2016
3 and 2/9. You just multiply 9 by 3 to get 27 and put the remaining 2 over 9
Answer Link
1047654
1047654 1047654
  • 21-09-2021

Answer:

3 2/9

Step-by-step explanation:

Answer Link

Otras preguntas

Assume $1 is currently equal to A$1.1024 in the spot market. Also assume the expected inflation rate in Australia is 2.8 percent as compared to 3.4 percent in t
In the developing chick vertebral limb bud, the zone of polarizing activity (ZPA) organizes a pattern along the anteroposterior axis. Transplantation of the ZPA
an animal cell on the left and plant cell on the right which two cell parts are most likely found in both types of cells
Friedrich von steuben trained troops from which side of the American revolution?
A bag contains 1 red, 1 yellow, 1 blue, and 1 green marble. What is the probability of choosing a green marble, not replacing it, and then choosing a red marble
A scatterplot shows: Select one: a. The proportion of data falling into different categories. b. Scores on one variable plotted against scores on a second var
what are the possible side lengths of a triangle
What is the slope of the line than passes through 3,5 and -1,5
Describe the events involved all the way to the brain when a person accidentally steps on a nail.
Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 5