yalelinarreola yalelinarreola

11-04-2019
History

contestada

What would an increase in US trade barries result in

What would an increase in US trade barries result in class=

Respuesta :

silversheep13 silversheep13

21-05-2019

Answer:

a decrease in trade for the United States

Explanation:

Often when an industry benefits from trade barriers, it also loses economic incentive to become more efficient and produce goods less expensively.

Answer Link

Otras preguntas

a 13 kg sled is moving at a speed of 3.0 m/s. at which of the following speedss will the sled have tace as mucb as the kinetic

Use the discriminant to describe the roots of each equation. Then select the best description. 2 = x2 + 5x

PLEASE HELP!!!! squared---> x+7 and x=9 simplify radical form

300 people died in Chicago what is the percent increase in victims from Chicago to the 2000 victims in peshtigo

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

A freight carrier charges $0.57 for a package weighing up to one ounce plus and additional $0.32 for each additional ounce or fraction of an ounce. A company is

Mr.jone wants to buy 6 tickets to a play.Each ticket costs $10 Mr.Jone has $45 in his pocket. How much more money does he need to buy 6 tickets?

Lyle deposited a check for $75.26. He’ll use the check register to record his transaction. What will be his new balance?

NEED ANSWER ASAP!!!!!! PLEASE HELPRead the excerpt from "Politics and the English Language" by George Orwell. To begin with, it has nothing to do with archaism,

Factor 4n²-21n-18 1. (4n-6)(n+3) 2.(n+6)(4n-3) 3.(n-6)(4n+3)