PurpleBeats
PurpleBeats PurpleBeats
  • 15-01-2019
  • History
contestada

What was the main idea of the Twelve Tables?

Respuesta :

Аноним Аноним
  • 24-01-2019

According to Roman tradition, the Law of the Twelve Tables (Latin: Leges Duodecim Tabularum or Duodecim Tabulae) was the legislation that stood at the foundation of Roman law. The Tables consolidated earlier traditions into an enduring set of laws.

Answer Link

Otras preguntas

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAAT
write an expression for b divided by 6(please only real answers, I am already failing I don't need more bs)​
Simple mathhh help please!!
The oxidation state for Cl is A. -1 as a reactant and +1 as a product B. -1 as a reactant and 0 as a product C. -1 as a reactant and -1 as a product D. +1 as a
Find Each side length- Round to the nearest tenth if possible.
A cylinder can has a radius of 5.5 and a height of 8cm what is the capacity of the can
the area is approximately ___ square ft. use 3.14 for pi​
Why is the right to vote (suffrage) an important right for all Americans? ​
Avery has a job where she has a take home salary each month of 1200. If Avery wants to spend no more then 25% of her monthly take home salary on rent , how much
Which statement is NOT a reason Rosa Parks was considered the “right” person to be the face of the Civil Rights Movement? a Rosa Parks was married and had a goo