hamichrit7178 hamichrit7178
  • 11-03-2024
  • Computers and Technology
contestada

Which following are types of data we worked with in excel files - check all that apply:
a) group of answers
b) surveys
c) dimensions
d) time
e) measures
f) categories
g) formulas
h) demographics

Respuesta :

Otras preguntas

Given f(x ) = 3x − 1 and (f ∘ g)(x ) = x , find g(x ) Please Help I need to answer this question
In the 1930s, advertisers for the DeBeers diamond company invented the singlehandedly revolutionizing the industry by implying that the only app diamond ring. T
Cos’ è Mobile o oggetto che si usa per appendere gli abiti?
Help Me Complete My Spanish Homework (Only Like 2.5 Pages Left To Do) Correct My Answers If They Are Wrong Thanks
Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.
A car uses 9 litres of petrol to travel 80 km. Petrol costs £1.35 How much does it cost to travel 400 km? per litre.
A road construction crew has planned a project to repave a highway with new asphalt. ● 2 miles of the highway had already been paved during a previous project.
optimus prime coasts up a hill initially at 11.0m/s. after 9.3s he is rolling back down the slope at 7.3m/s. what is his acceleration?
who is free talk to me....​
A car is coasting backward downhill at a speed of 3 . 0 m / s when the driver gets the engine started. After 2 . 5 s , the car is moving uphill at 4 .