littlee1513 littlee1513

15-01-2024
Business

contestada

The movement of information and the movement of goods is a function of which of the following?

a) logistics

b) CRM

c) Front-line forwarding

d) quality control

Respuesta :

Otras preguntas

How can 26 n − 7 m + 4 ( 10 n − 6 m ) be rewritten?

Lots of points and brainliest for help!!!! In 3–5 sentences, describe the causes and impact of the Ford Hunger March in Dearborn, Michigan, in 1932.

Which one produces the greatest amount of clean energy A. burning oil B. nuclear fission C. nuclear fusion D. burning coal

What does virginia Woolf tell us about having space?

Rate the drawing Will mark brainly if it’s good

I need help with this spanish

Have you ever bought something you thought would make you happy, but in the end it didn't?

What is the complementary strand of DNA to the one below? AAACCGTATCCGCGGTATATCGCCGGAAT

I WANT A FUNNY pls ill give brainliest just be FUNNEY

Which of these are components of DNA? Select five options