aidenlumpkins219 aidenlumpkins219
  • 13-11-2022
  • Biology
contestada

Using the following genomic sequence:


1) Underline each Intron


2) Circle each exon


GUUAUGAGUCGUUGGCAUUAAUCUUUCCUUAUGAUUGUCGCUGAUCGUUAG

UCGUCCAUGCGUGGUGGCUGACUUCCAAUGACCAAAUCUUCGGUGGCGGAG

UAACAUAUAAGAAUGACCAAAAGGCGUCGAUGAGGAUGUGGCAAUUAACAUC

Respuesta :

Otras preguntas

explain any three problems faced by the peasants of avad​
What is the advantage to use a multistage compression refrigeration system over a single stage compression system?
if 1.04 = 2 to the power of 1/j, how do I calcate j ? i know the answer should be 17.7
On 1 to 200 scale how tall is Statue of Liberty
Given a thermal conductivity constant of a material of 0 4, a surface area of 100 square feet, a temperature on the far side of a material of 165°F and a temper
A community athletic club holds an election to select a president and vice president. The nominations for selection include 4 females and 3 males. What is the p
In UNIX, how do I set the permissions on MyProgram.py to: rwx---r-x?
Which of the following is not among the three likely sources of heat during the formation of the Earth?
please help i'd really appreciate it.
explain any three problems faced by the peasants of avad​